Search results for "CA [SR]"
showing 10 items of 2784 documents
Limit on the production of a light vector gauge boson in $\phi $ mesondecays with the KLOE detector
2012
We present a new limit on the production of a light dark-force mediator with the KLOE detector at DAPHNE. This boson, called U, has been searched for in the decay phi --> eta U, U --> e+ e-, analyzing the decay eta --> pi0 pi0 pi0 in a data sample of 1.7 fb-1. No structures are observed in the e+e- invariant mass distribution over the background. This search is combined with a previous result obtained from the decay eta --> pi+ pi- pi0, increasing the sensitivity. We set an upper limit at 90% C.L. on the ratio between the U boson coupling constant and the fine structure constant of alpha'/alpha < 1.7x10^-5 for 30<M_U<400 MeV and alpha'/alpha < 8x10^-6 for the sub-region 50<M_U<210 MeV. This…
Cruise passengers' expenditure at destinations: Review of survey techniques and data collection
2020
Spending by cruise passengers constitutes an important contribution to the economy of destinations. The issues related to the analysis of the expenditure have been widely debated for many years both in the scientific literature and in the common political debate. Despite 20 years of empirical research on this topic, not consolidated quantification methods exist to inform the debate. This work offers a brief review of the principal research on cruise tourist spending. It analyses the main characteristics of the surveys, reviews the different methods and techniques employed as well as assesses the main results. The article concludes with a discussion of the studies conducted and identifies fu…
Population geocoding for healthcare management. Technical challenges and quality issues
2015
The present work aims at describing the main issues related with population geocoding for healthcare management. Some of the available procedures for geocoding multiple addresses are described and an indicator of quality of the geocoded addresses is proposed. As a case study, the geocoding of population addresses of a set of 9 Sicilian Municipalities is described and results deriving from the use of two different methods are compared in terms of quality. Some potential applications of population geocoding in healthcare management are finally discussed.
Justicia distributiva e igualdad compleja en el pensamiento de Michael Walzer
2014
Partiendo de la concepción walzeriana de justicia distributiva, esta tesis trata de analizar, mostrar y desarrollar la aplicación práctica que la idea de igualdad compleja puede tener en diferentes sociedades. Es por esto por lo que se analiza como ideal regulativo que nos permita juzgar hasta qué punto una sociedad es justa y de qué forma podríamos intentar ir progresivamente acercándonos a ese ideal con el objetivo de configurar sociedades más justas, libres, plurales e igualitarias. El trabajo se divide en dos partes: la primera de tipo fundacional, necesaria para poder seguir avanzando en la consecución de los objetivos propuestos y concerniente a los fundamentos filosóficos del pensami…
An analysis of Italian university students' performance through segmented regression models: gender differences in STEM courses
2021
AbstractThis paper investigates gender differences in university performances in Science, Technology, Engineering and Mathematics (STEM) courses in Italy, proposing a novel application through the segmented regression models. The analysis concerns freshmen students enrolled at a 3-year STEM degree in Italian universities in the last decade, with a focus on the relationship between the number of university credits earned during the first year (a good predictor of the regularity of the career) and the probability of getting the bachelor degree within 4 years. Data is provided by the Italian Ministry of University and Research (MIUR). Our analysis confirms that first-year performance is strong…
Socio-economic deprivation, territorial inequalities and mortality for cardiovascular diseases in Sicily
2016
The present work aims at analyzing the relationship among deprivation, distance from the nearest hospital and mortality for cardiovascular diseases in Sicily. Data derived from 2011 Census are used for the determination of the deprivation index at the municipality level, whereas distance from the municipality of residence and the nearest municipality with at least one hospital is considered in terms of travel time. Results highlight association between socio-economic conditions and mortality for cardiovascular diseases, whereas it seems that the distance from the hospital is only poorly associated with mortality.
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Typification of 14 names in the Dianthus virgineus group (Caryophyllaceae)
2021
The nomenclature of 14 taxa from Central and Southern Europe within the Dianthus virgineus group is discussed. Dianthus aggericola Jord., D. collivagus Jord., D. consimilis Jord., D. orophilus Jord., D. saxicola Jord., D. juratensis Jord. are here lectotypified by specimens from the Jordan herbarium in LY, while D. godronianus Jord. by a specimen in P. Dianthus subacaulis Vill. is neotypified by a specimen collected on Mont Ventoux (S. France) and housed in MPU. For D. sylvestris Wulfen, a lectotype is here designated and its previous neotypification is discussed. Dianthus caryophyllus var. tenuifolius Moris, D. caryophyllus f. minor Moris and D. sylvestris var. garganicus Ten. are lectotyp…
La Statistica nel processo di formazione: una sconosciuta opportunità per percorsi didattici innovativi
2017
Il lavoro argomenta l’importanza delle competenze di base in Statistica per tutti i cittadini e in particolar modo per gli studenti delle scuole di ogni ordine e grado. Muovendo dal presupposto che esiste un deficit di competenze degli studenti italiani, si propongono metodi e percorsi didattici che, attraverso la Statistica, possano far acquisire agli studenti le competenze chiave di cittadinanza. Vengono sottolineati alcuni aspetti critici inerenti la formazione degli insegnanti (in relazione ai saperi, alle metodologie e agli strumenti da adottare), ma anche le nuove opportunità che la riforma scolastica offre per una didattica della Statistica più consapevole ed efficace. Dopo aver disc…