Search results for "CA [SR]"

showing 10 items of 2784 documents

Limit on the production of a light vector gauge boson in $\phi $ mesondecays with the KLOE detector

2012

We present a new limit on the production of a light dark-force mediator with the KLOE detector at DAPHNE. This boson, called U, has been searched for in the decay phi --> eta U, U --> e+ e-, analyzing the decay eta --> pi0 pi0 pi0 in a data sample of 1.7 fb-1. No structures are observed in the e+e- invariant mass distribution over the background. This search is combined with a previous result obtained from the decay eta --> pi+ pi- pi0, increasing the sensitivity. We set an upper limit at 90% C.L. on the ratio between the U boson coupling constant and the fine structure constant of alpha'/alpha < 1.7x10^-5 for 30<M_U<400 MeV and alpha'/alpha < 8x10^-6 for the sub-region 50<M_U<210 MeV. This…

Dark forcesNuclear and High Energy PhysicsParticle physicsElectron–positron annihilationFOS: Physical sciences01 natural sciencesSettore FIS/04 - Fisica Nucleare e Subnuclearee(+)e(-) Collisions Dark forces Gauge vector bosonHigh Energy Physics - ExperimentNuclear physicsHigh Energy Physics - Experiment (hep-ex)e(+)e(-) Collisions0103 physical sciencesgauge vector bosonInvariant massNuclear Experiment010306 general physicsBosonPhysicsCoupling constantGauge boson$e^{+}e^{-}$ collisions010308 nuclear & particles physicsSettore FIS/01 - Fisica SperimentaleForm factor (quantum field theory)Vector meson dominancePhi mesondark forcesHigh Energy Physics::ExperimentGauge vector boson
researchProduct

Cruise passengers' expenditure at destinations: Review of survey techniques and data collection

2020

Spending by cruise passengers constitutes an important contribution to the economy of destinations. The issues related to the analysis of the expenditure have been widely debated for many years both in the scientific literature and in the common political debate. Despite 20 years of empirical research on this topic, not consolidated quantification methods exist to inform the debate. This work offers a brief review of the principal research on cruise tourist spending. It analyses the main characteristics of the surveys, reviews the different methods and techniques employed as well as assesses the main results. The article concludes with a discussion of the studies conducted and identifies fu…

Data collection methods of expenditureSurvey techniqueSampling schemeSettore SECS-S/05 - Statistica SocialeCruise passengers' expenditure
researchProduct

Population geocoding for healthcare management. Technical challenges and quality issues

2015

The present work aims at describing the main issues related with population geocoding for healthcare management. Some of the available procedures for geocoding multiple addresses are described and an indicator of quality of the geocoded addresses is proposed. As a case study, the geocoding of population addresses of a set of 9 Sicilian Municipalities is described and results deriving from the use of two different methods are compared in terms of quality. Some potential applications of population geocoding in healthcare management are finally discussed.

Data quality Population health Address geocoding Spatial databasesSettore SECS-S/05 - Statistica Sociale
researchProduct

Justicia distributiva e igualdad compleja en el pensamiento de Michael Walzer

2014

Partiendo de la concepción walzeriana de justicia distributiva, esta tesis trata de analizar, mostrar y desarrollar la aplicación práctica que la idea de igualdad compleja puede tener en diferentes sociedades. Es por esto por lo que se analiza como ideal regulativo que nos permita juzgar hasta qué punto una sociedad es justa y de qué forma podríamos intentar ir progresivamente acercándonos a ese ideal con el objetivo de configurar sociedades más justas, libres, plurales e igualitarias. El trabajo se divide en dos partes: la primera de tipo fundacional, necesaria para poder seguir avanzando en la consecución de los objetivos propuestos y concerniente a los fundamentos filosóficos del pensami…

DemocraciaCrítica socialIgualdad Compleja:CIENCIA POLÍTICA [UNESCO]:ÉTICA [UNESCO]UNESCO::CIENCIA POLÍTICAInterpretaciónUNESCO::FILOSOFÍA:FILOSOFÍA [UNESCO]UNESCO::ÉTICAJusticiaIgualdadMinimalismoJusticia distributivaWalzerSociedad CivilCortina
researchProduct

An analysis of Italian university students' performance through segmented regression models: gender differences in STEM courses

2021

AbstractThis paper investigates gender differences in university performances in Science, Technology, Engineering and Mathematics (STEM) courses in Italy, proposing a novel application through the segmented regression models. The analysis concerns freshmen students enrolled at a 3-year STEM degree in Italian universities in the last decade, with a focus on the relationship between the number of university credits earned during the first year (a good predictor of the regularity of the career) and the probability of getting the bachelor degree within 4 years. Data is provided by the Italian Ministry of University and Research (MIUR). Our analysis confirms that first-year performance is strong…

Demography. Population. Vital eventseducation05 social sciences050301 educationStudents’ performanceSTEM0506 political scienceSegmented regression050602 political science & public administrationBachelor degreeMathematics educationGender differencesGender differenceChristian ministryHigher educationHB848-3697Settore SECS-S/05 - Statistica SocialeSegmented regressionSettore SECS-S/01 - Statistica0503 educationDemographyMathematics
researchProduct

Socio-economic deprivation, territorial inequalities and mortality for cardiovascular diseases in Sicily

2016

The present work aims at analyzing the relationship among deprivation, distance from the nearest hospital and mortality for cardiovascular diseases in Sicily. Data derived from 2011 Census are used for the determination of the deprivation index at the municipality level, whereas distance from the municipality of residence and the nearest municipality with at least one hospital is considered in terms of travel time. Results highlight association between socio-economic conditions and mortality for cardiovascular diseases, whereas it seems that the distance from the hospital is only poorly associated with mortality.

Deprivation index Mortality Health researchSettore SECS-S/05 - Statistica Sociale
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Typification of 14 names in the Dianthus virgineus group (Caryophyllaceae)

2021

The nomenclature of 14 taxa from Central and Southern Europe within the Dianthus virgineus group is discussed. Dianthus aggericola Jord., D. collivagus Jord., D. consimilis Jord., D. orophilus Jord., D. saxicola Jord., D. juratensis Jord. are here lectotypified by specimens from the Jordan herbarium in LY, while D. godronianus Jord. by a specimen in P. Dianthus subacaulis Vill. is neotypified by a specimen collected on Mont Ventoux (S. France) and housed in MPU. For D. sylvestris Wulfen, a lectotype is here designated and its previous neotypification is discussed. Dianthus caryophyllus var. tenuifolius Moris, D. caryophyllus f. minor Moris and D. sylvestris var. garganicus Ten. are lectotyp…

Dianthus France Italy Slovenia NomenclatureSettore BIO/02 - Botanica SistematicaSouthern Europe and MediterraneanSloveniaBotanyCaryophyllaceaePlant ScienceSpecies InventoriesBiotaCaryophyllalesEuropeTracheophytaMagnoliopsidaItalyDianthusQK1-989nomenclatureFrancePlantaeDianthus humilisEcology Evolution Behavior and SystematicsDianthus; France; Italy; Slovenia; nomenclatureResearch ArticlePhytoKeys
researchProduct

La Statistica nel processo di formazione: una sconosciuta opportunità per percorsi didattici innovativi

2017

Il lavoro argomenta l’importanza delle competenze di base in Statistica per tutti i cittadini e in particolar modo per gli studenti delle scuole di ogni ordine e grado. Muovendo dal presupposto che esiste un deficit di competenze degli studenti italiani, si propongono metodi e percorsi didattici che, attraverso la Statistica, possano far acquisire agli studenti le competenze chiave di cittadinanza. Vengono sottolineati alcuni aspetti critici inerenti la formazione degli insegnanti (in relazione ai saperi, alle metodologie e agli strumenti da adottare), ma anche le nuove opportunità che la riforma scolastica offre per una didattica della Statistica più consapevole ed efficace. Dopo aver disc…

Didattica della statistica percorsi di insegnamentoSettore SECS-S/05 - Statistica Sociale
researchProduct

La Scuola Permanente per l'Aggiornamento degli Insegnanti di Scienze Sperimentali (SPAIS) Dieci anni di attività

2017

Didattica Ricerca Scientifica Formazione Insegnanti
researchProduct